Kennedyberman4695

Many species in the fungal Diaporthe (anamorph Phomopsis) genus have become a group of the most important pathogens that cause seed decay, stem and pot blight, and stem canker in soybean production worldwide, resulting in significant yield loss. selleck kinase inhibitor Due to increased disease prevalence but a lack of research, we performed an extensive field survey to isolate and identify the Diaporthe species associated with soybean stem blight in six provinces of China between 2019 and 2020. A total of 92 Diaporthe isolates were identified based on morphological and multi-locus phylogenetic analysis, and classified into six species D. longicolla, D. unshiuensis, D. sojae, D. caulivora, D. tectonigena, and an unknown Diaporthe sp. The most frequently identified species was D. longicolla with 57 isolates. High genetic diversity was observed for the D. longicolla isolates and haplotype network analysis revealed a mixed structure among the population in the six provinces. In comparative pathogenicity assays, different virulence levels were observed among the 92 Diaporthe isolates. The results of this study provide new insights into the Diaporthe spp. associated with soybean stem blight in China and can help in the development of effective management strategies.Daylilies (Hemerocallis spp.; Xanthorrhoeaceae) originated from Eastern Asia and are widely cultivated as perennial ornamentals from the tropics to their native high latitudes. In June 2021, daylily cultivar 'Tao Hua Zhai' with leaf spot symptoms were found at the Shanghai Institute of Technology, Shanghai, China. The disease prevalence was about 14.5 % in a 33,000 m2 planting area indicated by survey statistics. Symptoms of the disease initially appeared as small, circular, brown spots on the leaves. As disease progressed, spots increased gradually until they were distributed uniformly over the lamina, the leaf tip became withered and the rest of the leaf became chlorotic. Symptomatic leaf tissue pieces (5 × 5 mm) from lesion margins were sterilized with 75 % ethanol for 1 min, rinsed three times with sterile distilled water, then incubated on potato dextrose agar (PDA) plates at 28 °C in the dark. A pure culture (ATHF-1) was obtained. Its upper surface on PDA was olive green with loose aerial hyphae, and it1016/j.simyco.2015.07.001.Members of the Fusarium oxysporum complex are ubiquitous soilborne fungal pathogens causing wilt diseases in various plant hosts. Fusarium oxysporum (Fo) f. sp. cannabis was first reported causing wilt disease in hemp in Italy in 1962. To date, Fusarium wilt continues to cause concern in industrial and medicinal cannabis cultivation worldwide. During a 3-year period (2018 to 2021), Fo strains were isolated from medical cannabis plants (Cannabis sativa) exhibiting wilt symptoms that were cultivated in numerous commercial farms in Israel. A diverse set of these strains was subjected to molecular phylogenetic analyses to assess their genetic diversity and to compare them with other f. sp. cannabis isolates included in prior studies. Maximum likelihood bootstrap analysis of a partial translation elongation factor (TEF1) dataset, which included 24 f. sp. cannabis sequences, revealed that the 11 strains from Israel comprised five TEF1 haplotypes. Two of the haplotypes from Israel were identical to isolates previously reported from British Columbia and California and British Columbia and Ontario. Overall, the 24 f. sp. cannabis sequences included 12 unique TEF1 haplotypes. These were phylogenetically diverse, suggesting that pathogenicity to C. sativa may have evolved independently within the F. oxysporum complex. Pathogenicity tests of the Israeli strains were confirmed by Koch's postulates assays. Strains of the five different f. sp. cannabis TEF1 haplotypes all caused wilt in cannabis seedlings but with varying levels of aggressiveness. The same isolates that originated from asymptomatic infected mother plants were found in wilted cuttings indicating that the pathogen can be spread via propagation material.Fusarium solani FSSC 11 and F. tricinctum are important root rot pathogens of soybean in North Dakota. The roles of soil type, temperature and moisture in disease development by both species are poorly documented. To assess the effect of soil type on disease, three types of soil (Glyndon sandy loam, La prairie silt loam and Fargo clay) which represent soils of the soybean production region in the Red River Valley were examined in greenhouse and field studies. Disease incidence and lesion length on roots were evaluated at growth stages V3 and R6. Soil type significantly affected disease development, with higher severity in the lighter soils of Glyndon sandy loam and La Prairie silt loam compared to Fargo clay. Soil type also interacted with Fusarium species, in which the maximum severity was observed in Glyndon sandy loam for F. solani, and in La Prairie silt loam for F. tricinctum. The cumulative effects of soil type, temperature and soil moisture were tested in a growth chamber. Emergence and disease on seedstures of 20-80% WHC, while it was 40-80% WHC at 28oC. Disease caused by F. solani was favored by low temperature (18oC) with high soil moisture (60-80% WHC) or high temperature (28oC) with low soil moisture (20-40% WHC) while F. tricinctum was favored by cooler temperature and lower soil moisture.Crinum asiaticum (family Amaryllidaceae), locally known as 'Pokok Bakung', is an ornamental medicinal plant grown in Malaysia. It contains chemical compounds used for antimicrobial, antioxidant, antitumor, antiemetic and wound healing (Patel, 2017). In July 2021, 'Pokok Bakung' leaves with anthracnose symptoms were collected from a park of Universiti Malaysia Sabah in the Sabah province. The disease severity was about 100% with 20% incidence. Red spots were primarily found on the leaf surfaces. Anthracnose developed as the disease progressed, and acervuli were observed in the spots. Small pieces of infected leaves (5 x 5 mm) were excised from spot margins, surface sterilized based on Khoo et al. (2022a), placed on potato dextrose agar (PDA) in Petri dishes, which were incubated for 5 days at 25°C in the dark. The colonies formed on the PDA plates were abundant with gray-white fluffy mycelia after 5 days, and the reverse view revealed brown. UMS01, a representative isolate, was used to morphologically and molewth and production of C. asiaticum in Malaysia.Sponge gourd (Luffa cylindrica) and watermelon (Citrullus lanatus) are important cash crops in China. In September 2015, interveinal yellow spots and chlorosis, suspected to be caused by the tomato chlorosis virus (ToCV; genus Crinivirus), were observed on sponge gourd and watermelon plants in six greenhouses in the cities of Shouguang, Dezhou, and Taian (2 greenhouses in each city) of Shandong Province. The incidences of the disease in sponge gourd and watermelon greenhouses were 10% to 20%. To identify causative pathogens, 20 sponge gourd and 15 watermelon samples were collected from cucurbit plant facilities in Shandong Province, China. Total RNA was extracted from the samples using RNA simple Total RNA kit (Tiangen Biotech Co., Ltd., Beijing, China) according to the manufacturer's protocol. Reverse transcription-polymerase chain reaction (RT-PCR) of ToCV was performed using To-CP-forward (ATGGAGAACAGTGCTGTTGC)/To-CP-reverse (TTAGCAACCAGTTATCGATGC) primer pair (Hirota et al. 2010). DNA fragments of approxiof ToCV worldwide. We believe that spread of ToCV in cucurbits needs attention.New variants of severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) continue to arise and prolong the coronavirus disease 2019 (COVID-19) pandemic. Here, we used a cell-free expression workflow to rapidly screen and optimize constructs containing multiple computationally designed miniprotein inhibitors of SARS-CoV-2. We found the broadest efficacy was achieved with a homotrimeric version of the 75-residue angiotensin-converting enzyme 2 (ACE2) mimic AHB2 (TRI2-2) designed to geometrically match the trimeric spike architecture. Consistent with the design model, in the cryo-electron microscopy structure TRI2-2 forms a tripod at the apex of the spike protein that engaged all three receptor binding domains simultaneously. TRI2-2 neutralized Omicron (B.1.1.529), Delta (B.1.617.2), and all other variants tested with greater potency than the monoclonal antibodies used clinically for the treatment of COVID-19. TRI2-2 also conferred prophylactic and therapeutic protection against SARS-CoV-2 challenge when administered intranasally in mice. Designed miniprotein receptor mimics geometrically arrayed to match pathogen receptor binding sites could be a widely applicable antiviral therapeutic strategy with advantages over antibodies in greater resistance to viral escape and antigenic drift, and advantages over native receptor traps in lower chances of autoimmune responses.Large introductory science courses are a particularly important and challenging target for creating inclusive learning environments. In this study, we examined the impact of incorporating learning assistants (LAs) on the learning environment in an introductory biology course taught with two different structures an in-person lecture with intermittent active-learning components and an online setting taught with a flipped instructional approach. Using a survey that measured sense of belonging in a single class, we found that students in sections with LAs reported greater sense of belonging than students in sections without LAs in both class structures. Further, student focus groups revealed that LAs promoted learning and engagement in the class by answering questions and providing clarity; allowing more use of active- and interactive-learning structures; and serving as accessible, approachable, and immediate sources of help. Student responses also indicated that LAs promoted a sense of belonging in science, technology, engineering, and mathematics (STEM) by decreasing feelings of isolation, serving as inspirational role models, clarifying progression through the STEM educational system, and helping students become more engaged and confident in their STEM-related knowledge and skills. These findings indicate that LAs can support multiple elements of inclusive STEM learning environments.Israel was one of the first countries to administer mass vaccination against severe acute respiratory syndrome coronavirus 2. Consequently, it was among the first countries to experience substantial breakthrough infections due to the waning of vaccine-induced immunity, which led to a resurgence of the epidemic. In response, Israel launched a booster campaign to mitigate the outbreak and was the first country to do so. Israel's success in curtailing the Delta resurgence while imposing only mild nonpharmaceutical interventions influenced the decision of many countries to initiate a booster campaign. By constructing a detailed mathematical model and calibrating it to the Israeli data, we extend the understanding of the impact of the booster campaign from the individual to the population level. We used the calibrated model to explore counterfactual scenarios in which the booster vaccination campaign is altered by changing the eligibility criteria or the start time of the campaign and to assess the direct and indirect effects in the different scenarios.