Ratliffgram7804

In this study, we compared the fecal microbiota and metabolomes of 26 healthy subjects before (HS) and after (HSB) 2 months of diet intervention based on the administration of durum wheat flour and whole-grain barley pasta containing the minimum recommended daily intake (3 g) of barley β-glucans. Metabolically active bacteria were analyzed through pyrosequencing of the 16S rRNA gene and community-level catabolic profiles. Pyrosequencing data showed that levels of Clostridiaceae (Clostridium orbiscindens and Clostridium sp.), Roseburia hominis, and Ruminococcus sp. increased, while levels of other Firmicutes and Fusobacteria decreased, from the HSB samples to the HS fecal samples. Community-level catabolic profiles were lower in HSB samples. Compared to the results for HS samples, cultivable lactobacilli increased in HSB fecal samples, while the numbers of Enterobacteriaceae, total coliforms, and Bacteroides, Porphyromonas, Prevotella, Pseudomonas, Alcaligenes, and Aeromonas bacteria decreased. buy Cariprazine Metabolome analyses were performed using an amino acid analyzer and gas chromatography-mass spectrometry solid-phase microextraction. A marked increase in short-chain fatty acids (SCFA), such as 2-methyl-propanoic, acetic, butyric, and propionic acids, was found in HSB samples with respect to the HS fecal samples. Durum wheat flour and whole-grain barley pasta containing 3% barley β-glucans appeared to be effective in modulating the composition and metabolic pathways of the intestinal microbiota, leading to an increased level of SCFA in the HSB samples.Shiga-toxigenic bacteriophages are converting lambdoid phages that impart the ability to produce Shiga toxin to their hosts. Little is known about the function of most of the genes carried by these phages or the impact that lysogeny has on the Escherichia coli host. Here we use next-generation sequencing to compare the transcriptomes of E. coli strains infected with an Stx phage, before and after triggering of the bacterial SOS response that initiates the lytic cycle of the phage. We were able to discriminate between bacteriophage genes expressed in the lysogenic and lytic cycles, and we describe transcriptional changes that occur in the bacterial host as a consequence of Stx phage carriage. Having identified upregulation of the glutamic acid decarboxylase (GAD) operon, confirmed by reverse transcription-quantitative PCR (RT-qPCR), we used phenotypic assays to establish the ability of the Stx prophage to confer a greater acid resistance phenotype on the E. coli host. Known phage regulators were overexpressed in E. coli, and the acid resistance of the recombinant strains was tested. The phage-encoded transcriptional regulator CII was identified as the controller of the acid response in the lysogen. Infection of an E. coli O157 strain, from which integrated Stx prophages were previously removed, showed increased acid resistance following infection with a nontoxigenic phage, ϕ24B. In addition to demonstrating this link between Stx phage carriage and E. coli acid resistance, with its implications for survival postingestion, the data set provides a number of other potential insights into the impact of lambdoid phage carriage on the biology of E. coli.The role that neutrophilic iron-oxidizing bacteria play in the Arctic tundra is unknown. This study surveyed chemosynthetic iron-oxidizing communities at the North Slope of Alaska near Toolik Field Station (TFS) at Toolik Lake (lat 68.63, long -149.60). Microbial iron mats were common in submerged habitats with stationary or slowly flowing water, and their greatest areal extent is in coating plant stems and sediments in wet sedge meadows. link2 Some Fe-oxidizing bacteria (FeOB) produce easily recognized sheath or stalk morphotypes that were present and dominant in all the mats we observed. The cool water temperatures (9 to 11°C) and reduced pH (5.0 to 6.6) at all sites kinetically favor microbial iron oxidation. A microbial survey of five sites based on 16S rRNA genes found a predominance of Proteobacteria, with Betaproteobacteria and members of the family Comamonadaceae being the most prevalent operational taxonomic units (OTUs). In relative abundance, clades of lithotrophic FeOB composed 5 to 10% of the communities. OTUs related to cyanobacteria and chloroplasts accounted for 3 to 25% of the communities. Oxygen profiles showed evidence for oxygenic photosynthesis at the surface of some mats, indicating the coexistence of photosynthetic and FeOB populations. The relative abundance of OTUs belonging to putative Fe-reducing bacteria (FeRB) averaged around 11% in the sampled iron mats. Mats incubated anaerobically with 10 mM acetate rapidly initiated Fe reduction, indicating that active iron cycling is likely. The prevalence of iron mats on the tundra might impact the carbon cycle through lithoautotrophic chemosynthesis, anaerobic respiration of organic carbon coupled to iron reduction, and the suppression of methanogenesis, and it potentially influences phosphorus dynamics through the adsorption of phosphorus to iron oxides.(R)-Specific enoyl-coenzyme A (enoyl-CoA) hydratases (PhaJs) are capable of supplying monomers from fatty acid β-oxidation to polyhydroxyalkanoate (PHA) biosynthesis. PhaJ1Pp from Pseudomonas putida showed broader substrate specificity than did PhaJ1Pa from Pseudomonas aeruginosa, despite sharing 67% amino acid sequence identity. In this study, the substrate specificity characteristics of two Pseudomonas PhaJ1 enzymes were investigated by site-directed mutagenesis, chimeragenesis, X-ray crystallographic analysis, and homology modeling. In PhaJ1Pp, the replacement of valine with isoleucine at position 72 resulted in an increased preference for enoyl-coenzyme A (CoA) elements with shorter chain lengths. Conversely, at the same position in PhaJ1Pa, the replacement of isoleucine with valine resulted in an increased preference for enoyl-CoAs with longer chain lengths. These changes suggest a narrowing and broadening in the substrate specificity range of the PhaJ1Pp and PhaJ1Pa mutants, respectively. However, the substrate specificity remains broader in PhaJ1Pp than in PhaJ1Pa. Additionally, three chimeric PhaJ1 enzymes, composed from PhaJ1Pp and PhaJ1Pa, all showed significant hydratase activity, and their substrate preferences were within the range exhibited by the parental PhaJ1 enzymes. The crystal structure of PhaJ1Pa was determined at a resolution of 1.7 Å, and subsequent homology modeling of PhaJ1Pp revealed that in the acyl-chain binding pocket, the amino acid at position 72 was the only difference between the two structures. These results indicate that the chain-length specificity of PhaJ1 is determined mainly by the bulkiness of the amino acid residue at position 72, but that other factors, such as structural fluctuations, also affect specificity.Magnetotactic bacteria are capable of forming nanosized, membrane-enclosed magnetosomes under iron-rich and oxygen-limited conditions. The complete genomic sequence of Magnetospirillum gryphiswaldense strain MSR-1 has been analyzed and found to contain five fur homologue genes whose protein products are predicted to be involved in iron homeostasis and the response to oxidative stress. Of these, only the MGMSRv2_3149 gene (irrB) was significantly downregulated under high-iron and low-oxygen conditions, during the transition of cell growth from the logarithmic to the stationary phase. The encoded protein, IrrB, containing the conserved HHH motif, was identified as an iron response regulator (Irr) protein belonging to the Fur superfamily. To investigate the function of IrrB, we constructed an irrB deletion mutant (ΔirrB). The levels of cell growth and magnetosome formation were lower in the ΔirrB strain than in the wild type (WT) under both high-iron and low-iron conditions. The ΔirrB strain also showed lower levels of iron uptake and H2O2 tolerance than the WT. Quantitative real-time reverse transcription-PCR analysis indicated that the irrB mutation reduced the expression of numerous genes involved in iron transport, iron storage, heme biosynthesis, and Fe-S cluster assembly. Transcription studies of the other fur homologue genes in the ΔirrB strain indicated complementary functions of the Fur proteins in MSR-1. IrrB appears to be directly responsible for iron metabolism and homeostasis and to be indirectly involved in magnetosome formation. We propose two IrrB-regulated networks (under high- and low-iron conditions) in MSR-1 cells that control the balance of iron and oxygen metabolism and account for the coexistence of five Fur homologues.Saccharomyces cerevisiae has recently been engineered to use acetate, a primary inhibitor in lignocellulosic hydrolysates, as a cosubstrate during anaerobic ethanolic fermentation. However, the original metabolic pathway devised to convert acetate to ethanol uses NADH-specific acetylating acetaldehyde dehydrogenase and alcohol dehydrogenase and quickly becomes constrained by limited NADH availability, even when glycerol formation is abolished. We present alcohol dehydrogenase as a novel target for anaerobic redox engineering of S. cerevisiae. Introduction of an NADPH-specific alcohol dehydrogenase (NADPH-ADH) not only reduces the NADH demand of the acetate-to-ethanol pathway but also allows the cell to effectively exchange NADPH for NADH during sugar fermentation. Unlike NADH, NADPH can be freely generated under anoxic conditions, via the oxidative pentose phosphate pathway. We show that an industrial bioethanol strain engineered with the original pathway (expressing acetylating acetaldehyde dehydrogenase from Bifidobacterium adolescentis and with deletions of glycerol-3-phosphate dehydrogenase genes GPD1 and GPD2) consumed 1.9 g liter(-1) acetate during fermentation of 114 g liter(-1) glucose. Combined with a decrease in glycerol production from 4.0 to 0.1 g liter(-1), this increased the ethanol yield by 4% over that for the wild type. We provide evidence that acetate consumption in this strain is indeed limited by NADH availability. By introducing an NADPH-ADH from Entamoeba histolytica and with overexpression of ACS2 and ZWF1, we increased acetate consumption to 5.3 g liter(-1) and raised the ethanol yield to 7% above the wild-type level.The 3-phenoxybenzoate (3-PBA) 1',2'-dioxygenase gene cluster (pbaA1A2B cluster), which is responsible for catalyzing 3-phenoxybenzoate to 3-hydroxybenzoate and catechol, is inducibly expressed in Sphingobium wenxiniae strain JZ-1(T) by its substrate 3-PBA. In this study, we identified a transcriptional activator of the pbaA1A2B cluster, PbaR, using a DNA affinity approach. link3 PbaR is a 253-amino-acid protein with a molecular mass of 28,000 Da. PbaR belongs to the IclR family of transcriptional regulators and shows 99% identity to a putative transcriptional regulator that is located on the carbazole-degrading plasmid pCAR3 in Sphingomonas sp. strain KA1. Gene disruption and complementation showed that PbaR was essential for transcription of the pbaA1A2B cluster in response to 3-PBA in strain JZ-1(T). However, PbaR does not regulate the reductase component gene pbaC. An electrophoretic mobility shift assay and DNase I footprinting showed that PbaR binds specifically to the 29-bp motif AATAGAAAGTCTGCCGTACGGCTATTTTT in the pbaA1A2B promoter area and that the palindromic sequence (GCCGTACGGC) within the motif is essential for PbaR binding.