Hollowaynixon7326

Lactic acid bacteria (LAB) play a significant role in food industry and artisan fermented-food. Most of the applicable LABs were commonly obtained from natural fermented food or human gut. And Lactobacillus plantarum NCU116 was screened from a LAB-dominated traditional Chinese sauerkraut (TCS). In order to comprehend the interaction between NCU116 and its environments, comparative genomics were performed to identify genes involved in extracellular protein biosynthesis and secretion. Four secretory pathways were identified, including Sec and FPE pathways, holins and efflux ABC transporter system. Then 348 potential secretory proteins were identified, including 11 alpha-amylases responsible for degradation of macromolecules, and 8 mucus binding proteins which attribute to adherence to intestine epithelium. Besides, EPS clusters of NCU116 (EPS116) were identified and analyzed by comparing to other strains, which suggested a novel genotype of EPS clusters. These findings could be critical to extend the application of NCU116 in food and pharmaceuticals industries. Nitrogen (N) is an essential macronutrient for plants, and mainly taken from the soil as ammonium (NH+4). It is particularly transported into the plants by AMmonium Transporters (AMTs), which are plasma membrane proteins. In the present study, genome-wide identification, physiological and expression analyses of tomato (Solanum lycopersicum L.) ammonium transporters 1 (SlAMT1) genes under drought and salt stresses were performed. Sequence analyses revealed the presence of variations in SlAMT1s at nucleotide and protein levels. While all the SlAMT1s comprise an ammonium transporter domain (PF00909), the numbers of their transmembrane helices were found to be diverse. Digital expression analyses proved that SlAMT1-3 gene had different expression patterns compared to the others, suggesting its functional diversities. The expression analyses revealed that SlAMT1 genes were 0.16 and 5.94 -fold down-regulated under drought and salt stresses, respectively. The results suggested that expression of SlAMT1 genes were adversely affected by abiotic stress conditions. Single Nucleotide Polymorphism (SNP) is one of the important molecular markers widely used in animal breeding program for improvement of any desirable genetic traits. Considering this, the present study was carried out to identify, annotate and analyze the SNPs related to four important traits of buffalo viz. milk volume, age at first calving, post-partum cyclicity and feed conversion efficiency. We identified 246,495, 168,202, 74,136 and 194,747 genome-wide SNPs related to mentioned traits, respectively using ddRAD sequencing technique based on 85 samples of Murrah Buffaloes. Distribution of these SNPs were highest (61.69%) and lowest (1.78%) in intron and exon regions, respectively. Under coding regions, the SNPs for the four traits were further classified as synonymous (4697) and non-synonymous (3827). Moreover, Gene Ontology (GO) terms of identified genes assigned to various traits. These characterized SNPs will enhance the knowledge of cellular mechanism for enhancing productivity of water buffalo through molecular breeding. Telomeres, the nucleoprotein structures, located at the end of the chromosomes are correlated with cancer and aging. The accelerated telomere attrition can accelerate human aging and leads to the progression of several cancers. Our work describes the finding of two novel telomeric repeats "CACAGA" and "TCTCTGCGCCTGCGCCGGCGCGGCGCGCC" and demonstrates their distribution in human chromosomes compare to the reported telomeric repeat TTAGGG. Simultaneously, the distance between the adjacent telomeric repeats (loop) was determined and the presence of shorter loops in the telomeric regions might address the correlation between the telomere attrition and senescence condition in human. OBJECTIVE The objective was to find the role of long-non-coding RNA zinc finger antisense 1 (lncRNA ZFAS1)/microRNA (miR)-129/high-mobility group box protein 1 (HMGB1) axis in polycystic ovary syndrome (PCOS). METHODS Ovarian granulosa cells from non-PCOS patients and PCOS patients were collected, and HMGB1, miR-129 and lncRNA ZFAS1 expression were detected. Ovarian granulosa cells were transfected with si-ZFAS1 or miR-129 mimics to verify their roles in P4 and E2 secretion, and the biological functions of ovarian granulosa cells. RESULTS LncRNA ZFAS1 and HMGB1 were elevated, while miR-129 was down-regulated in ovarian granulosa cells of PCOS patients. Down-regulated lncRNA ZFAS1 or overexpressed miR-129 could decrease HMGB1 expression, increase P4 and E2 secretion, promote proliferation activity while inhibit apoptosis of ovarian granulosa cells in PCOS. CONCLUSION LncRNA ZFAS1 could bind to miR-129 to promote HMGB1 expression, thereby affecting the endocrine disturbance, proliferation and apoptosis of ovarian granulosa cells in PCOS. Nano-drug/gene delivery systems (DDS) are powerful weapons for the targeted delivery of various therapeutic molecules in treatment of tumors. Nano systems are being extensively investigated for drug and gene delivery applications because of their exceptional ability to protect the payload from degradation in vivo, prolong circulation of the nanoparticles (NPs), realize controlled release of the contents, reduce side effects, and enhance targeted delivery among others. SM04690 However, the specific properties required for a DDS vary at different phase of the complex delivery process, and these requirements are often conflicting, including the surface charge, particle size, and stability of DDS, which severely reduces the efficiency of the drug/gene delivery. Therefore, researchers have attempted to fabricate structure, size, or charge changeable DDS by introducing various tumor microenvironment (TME) stimuli-responsive elements into the DDS to meet the varying requirements at different phases of the delivery process, thus improving drug/gene delivery efficiency. This paper summarizes the most recent developments in TME stimuli-responsive DDS and addresses the aforementioned challenges. Colorectal cancer (CRC) is the third most common and the second deadliest type of cancer worldwide, urging the development of more comprehensive models and of more efficient treatments. Although the combination of nanotechnology with chemo- and immuno-therapy has represented a promising treatment approach, its translation to the clinic has been hampered by the absence of cellular models that can provide reliable and predictive knowledge about the in vivo efficiency of the formulation. Herein, a 3D model based on CRC multicellular tumor spheroids (MCTS) model was developed by combining epithelial colon cancer cells (HCT116), human intestinal fibroblasts and monocytes. The developed MCTS 3D model mimicked several tumor features with cells undergoing spatial organization and producing extracellular matrix, forming a mass of tissue with a necrotic core. Furthermore, monocytes were differentiated into macrophages with an anti-inflammatory, pro-tumor M2-like phenotype. For a combined chemoimmunotherapy effect, spermine-modified acetalated dextran nanoparticles (NPs) loaded with the chemotherapeutic Nutlin-3a (Nut3a) and granulocyte-macrophage colony-stimulating factor (GM-CSF) were produced and tested in 2D cultures and in the MCTS 3D model.